is an atpdependent drug efflux pump that transports a wide variety of structurally unrelated compounds out of cells pgp possesses a linker region of75 amino acids that connects two homologous halves
... Authors Journal compilation ª 2009 FEBS 127 An anthrax lethal factor mutant thatis defective atcausing pyroptosis retains proapoptotic activityStephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy ... ofaminoacidsthat has previouslybeen implicated in binding MAPKKs [22]. Glu682 is within an a- helix that also contains the aminoacids A BFig. 1. An LF double mutant, LF-K518E ⁄ E682G. (A) ... MogridgeDepartment of Laboratory Medicine and Pathobiology, University of Toronto, CanadaIntroductionBacillus anthracis lethal toxin (LeTx) isa binary toxin that is released by the bacterium during an...
... kém phần quan trọng được nuôi ở Hậu Giang ,An Giang, Cà Mau, Cần Thơ •Ở Hậu Giang cá thát lát cờm coi như là một món ăn nổi tiếng.Thường xuyên bổ sung vitamin C và men tiêu h a cho cá.•Thu ... SINH HỌC a) Về sinh học : - Thát lát hay còn gọi là Asian knifefish phân bố ở Ấn Độ , Thailand , Mianma, Lao, Malaysia,Việt Nam Chúng có khả năng sống hầu hết các thủy vực nước ngọt có thực ... độ môi trường và nước ao thay đổi.•Người ta nói rằng : “Đi du lịch Hậu Giang mà không ăn được cá thát lát cờm coi như thiếu sót lớn”. (Theo baocantho.com.vn).Cải tạo ao nuôiDọn cỏ, tát nước,...
... indexer isa smart array in exactly the same way thata property isa smart field. The syntax that you use for an indexer is exactly the same as the syntax you use for an array. Let's work ... array; that is, on a type that declares an indexer. So the solution to the problem is to create a new type that acts like, feels like, and is used like an array of bool variables but is implemented ... However, because arrays are reference types, the variable myData refers to the same object as the private data variable in the Wrapper struct. Any changes you make to elements in myData are made to...
... iteration variable of the foreach statement isa read-only copy of each element of the array. Copying Arrays Arrays are reference types. An array variable contains a reference to an array instance. ... (where each element isa Time). Creating Array Instances Arrays are reference types, regardless of the type of their elements. This means thatan array variable refers to an array instance on ... heap) thatan array variable refers to, you have to do two things. First, you need to create a new array instance of the same type and the same length as the array you are copying, as in this...
... thoái h a rất phổ biến là đục nhân mắt và chấm đen trong mắt, ngăn chặn nguy cơ mắc các bệnh ung thư. Chọn nhiều loại rau gồm các loại rau nhiều lá, rau xanh, rau lá sậm, các loại rau và hoa quả ... có thói quen ăn rất nhanh để vội vã đi làm việc khác ngay sau đó. Ăn nhanh không chỉ làm xấu đi hình ảnh c a bạn mà còn khiến bạn tăng cân. Nếu như bạn hoàn thành một b aăn chỉ trong vòng 5 ... tạo hứng thú cho b a ăn, cần thay đổi món thường xuyên, thay đổi cách chế biến cũng như cách trình bày. Hứng thú trong b aăn còn từ sự vui vẻ, ấm cúng c a mọi người cùng ăn mang lại. Do đó,...
... class of inhibitors of membrane ATPasesfrom microorganisms, animal cells, and plant cells. ProcNatl Acad Sci USA 85, 7972–7976.45 Yoshimori T, Yamamoto A, Moriyama Y, Futai M &Tashiro ... USAProteins of the PA-TM-RING family have a protease-associated (PA) domain and a RING finger domainseparated by a transmembrane (TM) domain. PAdomains are 120–210 amino acid sequences located ... recentstudy established that RNF13 isan E3 ubiquitin ligasewhose expression is increased in pancreatic ductal ade-nocarcinoma tissues, suggesting that the protein mayparticipate in pancreatic cancer...
... CGCGAATTCCTTATGAAGAAGCTCCGTC EcoRIALA-4 CTTCAACAGACAAGTCCREP 4A AGCAATACTAGTTTTATA SpeIREP4B CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG NheIACMHIS AGGAGATCTGCGACTAACTCATCAGAGG BglIIAcmArevnru ... GCATGAATTCATCGCGAACTGCTATTGGTTCCAG NruIAcmAFsca GGTACTGCCGGGCCTCCTGCGGAcmArep2F ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCGAcmArep3F TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGGAcmAreveco AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC ... housekeepingprotease of L. lactis IL1403, HtrA, is capable of degra-ding AcmA. No AcmA degradation products werefound in an htrA knockout mutant, in which HtrA is not expressed.AcmA consists ofan active...
... and S6 do not, as far as is known, bind actin and may stick out from the filament as illustrated.Table 1. Summary of binding of gelsolin peptide 159–193 and cofilin to various parts of actin and ... Con-trol assays were carried out in wells saturated with gelatinand gelatin hydrolysate used alone. Each assay was con-ducted in triplicate and the mean value plotted after sub-traction of nonspecific ... G- and F-actins, promotes nucleationand both severs and caps actin filaments. Cofilin belongs toanother family of actin-binding proteins that also seversactin filaments and increases polymerization...
... diameters of the bacterial clearancezones were measured.Cytotoxicity assayThe toxicity of fowlicidin-3 toward mammalian epithelial cells was evaluated by using MDCK cells (ATCC) and an Alamar ... be an excellent candidate for future development as a novel antimicrobial andantisepsis agent, particularly against antibiotic-resistant pathogens.AbbreviationsCCL, CC chemokine ligand; CFU, colony ... Biochemistry, Kansas State University, Manhattan, KS, USA3 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USACationic antimicrobial peptides comprise a large...
... classified as an M homopolymer and that the H2 chain from S. gairdnerishould be likewise considered an M chain.The amino- acid residues of functional relevance inmammalian L and H chains are a ... solution (a- cyano-4-hydroxy-cinnamic acid) for MALDI-TOF MS analysis.Structure comparison A search of the SwissProt-TrEMBLE database, pairwiseand m ultiple s equence a lignments, and prediction of ... micellenucleation site, typical of mammalian L chains. C omparison of the amino- acid sequence w ith those available from lowervertebrates indicates that T. bernacchii ferritin can beclassified a s an...
... Van, M.E 5BÍ QUYẾT ĐỂ DỰ ÁN THÀNH CÔNG (tt)Bí quyết quan trọng nhất: GIAO TIẾP TỐT, PHỐI HỢP TỐTCÁC MỐI QUAN HỆ VỚI NHÀ THẦU THI CÔNG: Hình thành môi trường hợp tác gi a các bên tham gia. ... bất đồng không phải là tệ hại CNDA nên giử vai trò trung gian để h a giải Mối quan hệ tốt đẹp gi a chủ đầu tư và nhà thầu thi công là cần thiếtLuu Truong Van, M.E 9CÁC NGUYÊN NHÂN CHÍNH ... c a công việcLuu Truong Van, M.E 6CÁC NGUYÊN NHÂN CHÍNH LÀM DỰ ÁN THẤT BẠI• Các dự ánthất bại vì những nguyên nhân sau:– Quan niệm sai và hiểu sai về dự án– Chỉ có “nhóm dự án” là quan...
... ofthatof APX-B, and thatof the spinachstromal APX sample was 140% ofthatof APX-B. Bycomparing specific activities per protein and perabsorbance of Soret peak, the purity of these fiveAPXs ... Yoshimura K, Ishikawa T, Nakamura Y, Tamoi M,Takeda T, Tada T, Nishimura K & Shigeoka S (1998)Comparative study on recombinant chloroplastic andcytosolic ascorbate peroxidase isozymes of spinach.Arch ... higher plants as well as ascorbate peroxidaseB, an ascorbate peroxidase ofa red alga Galdieria partita, are relativelytolerant. We constructed various chimeric ascorbate peroxidases in whichregions...